View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_high_30 (Length: 352)
Name: NF16768_high_30
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 73 - 342
Target Start/End: Original strand, 12321622 - 12321891
Alignment:
| Q |
73 |
tccctctcttatgctgaagatgagtagcgccaatgccctatgaggccaagacctctcatcctcgtaagaggcagtggtagaactaacatatgaatgcgca |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12321622 |
tccctctcttatgctgaagatgagtagcgccaatgccctatgaggccaagacctctcatcctcgtaagaggcagtggtagaactaacatatgaatgcgca |
12321721 |
T |
|
| Q |
173 |
tttgaccacttttgattctggaaaacaaggacggctcaacactcctagtaggcacagtccctcactgaaatggagcaaggatggctcaacactccttgca |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12321722 |
tttgaccacttttgattctggaaaacaaggacgactcaacactcctagtaggcacagtccctcactgaaatggagcaaggatggctcaacactccttgca |
12321821 |
T |
|
| Q |
273 |
ggcactacccctcgctaaaatggagcgttaaagaaaatgaagactgaaattccctccgaaaatccctatg |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12321822 |
ggcactacccctcgctaaaatggagcgttaaagaaaatgaaaactgaaattccctccgaaaatccctatg |
12321891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 12321497 - 12321571
Alignment:
| Q |
1 |
tctttccgacatcatattattcgaaccggatcatcatttccggcatcggcttattcagaccggattatcttttcc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12321497 |
tctttccgacatcatattattcgaaccggatcatcatttccggcatcggattattcagaccggattatcttttcc |
12321571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University