View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_high_43 (Length: 261)
Name: NF16768_high_43
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 9090925 - 9090694
Alignment:
| Q |
11 |
cagagagaagttcgcaatagataacactacgtgcagttctatatgcatgcacatacttatttgatgaggataggaaatcttctcagttggttttgtaaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9090925 |
cagagagaagttcgcaatagataacactacgtgcagttctatatgcatgcacatacttatttggtgaggataggaaatcttctcagttggttttgtaaaa |
9090826 |
T |
 |
| Q |
111 |
tcagcaacattggcaacggtgataccccacttaaatgcaggtgcccaaaagtgaactgcacaacaaaagtggtcaattaatggattgatacaggtttgac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9090825 |
tcagcaacattggcaacggtgataccccacttaaatgcaggtgcccaaaagtgaactgcacaacaaaagtggtcaattaatggattgatacaggtttgac |
9090726 |
T |
 |
| Q |
211 |
aataacaatgctaacacttgacaacaacactg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9090725 |
aataacaatgctaacacttgacaacaacactg |
9090694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 53 - 188
Target Start/End: Complemental strand, 9095229 - 9095094
Alignment:
| Q |
53 |
atgcatgcacatacttatttgatgaggataggaaatcttctcagttggttttgtaaaatcagcaacattggcaacggtgataccccacttaaatgcaggt |
152 |
Q |
| |
|
|||||||| ||||| |||||| ||||||||||||| |||||||| |||||||| ||||||||||| |||||||| | |||||||||||||||||| ||| |
|
|
| T |
9095229 |
atgcatgcgcatacctatttgttgaggataggaaagcttctcaggtggttttgcaaaatcagcaatattggcaatgctgataccccacttaaatgtaggg |
9095130 |
T |
 |
| Q |
153 |
gcccaaaagtgaactgcacaacaaaagtggtcaatt |
188 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |
|
|
| T |
9095129 |
gcccaaaagtgaactgcacaaaataagtggtcaatt |
9095094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University