View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_high_48 (Length: 246)
Name: NF16768_high_48
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 79 - 224
Target Start/End: Original strand, 34120766 - 34120911
Alignment:
| Q |
79 |
atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120766 |
atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt |
34120865 |
T |
 |
| Q |
179 |
gatgatagcaagaaattcacaacattatgatccatcataaacatta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120866 |
gatgatagcaagaaattcacaacattatgatccatcataaacatta |
34120911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University