View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_18 (Length: 440)
Name: NF16768_low_18
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 14 - 425
Target Start/End: Complemental strand, 6619947 - 6619536
Alignment:
| Q |
14 |
caaaggtgggaaaatctactacattccaaacccatggcgggaaacaaaaaatttcctatctcgtcataaccgtacatttacttccttaatcgaacggcta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6619947 |
caaaggtgggaaaatctactacattccaaacccatggcgggaaacaaaaaatttcctatctcgtcataaccgtacatttactttcttaatcgaacggcta |
6619848 |
T |
|
| Q |
114 |
taaacaccgcaatcacaacttcttataaaccaaagtgtgacttcaaacattaatctattacaatcctttttcattcttcaccggtcacaaacacaaaccc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6619847 |
taaacaccgcaatcacaacttcttataaaccaaagtgtgacttcaaacattaatttattacaatcctttttcattcttcaccggtcacaaacacaaaccc |
6619748 |
T |
|
| Q |
214 |
ttgaattcaagaatccatggcgaaactgtcgaagcaacaaccttcttccgacgaagaaccggtgaactctttgtcggaggaagagcaagtcaatgaagag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6619747 |
ttgaattcaagaatccatggcgaaactgtcgaagcaacaaccttcttccgacgaagaaccggtgaactctttgtcggaggaagagcaagtgaatgaagag |
6619648 |
T |
|
| Q |
314 |
atcaacgaagaagaagatcaagaggagttggaagctgttgctcgtgctgttagttccgatgatgatgatgaagtcgctggggataatcctccggattctg |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6619647 |
atcaacgaagaagaagatcaagaggagttggaagctgttgctcgtgctgttagttccgatgatgatgatgaagtcgctggggaaaatcctccggattctg |
6619548 |
T |
|
| Q |
414 |
atgcagatgttg |
425 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6619547 |
atgcagatgttg |
6619536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University