View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_26 (Length: 385)
Name: NF16768_low_26
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 3e-70; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 225 - 363
Target Start/End: Complemental strand, 45342084 - 45341946
Alignment:
| Q |
225 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342084 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
45341985 |
T |
 |
| Q |
325 |
ttttgtcgttatgcgtaccgttactacaggattgggatt |
363 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45341984 |
ttttgtcgttatgcgtaccgttattacaggattgggatt |
45341946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 45342160 - 45342116
Alignment:
| Q |
186 |
caaaaatcactgttaatttgtagattcattgctattgctatgatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342160 |
caaaaatcactgttaatttgtagattcattgctattgctatgatt |
45342116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 132
Target Start/End: Complemental strand, 45342272 - 45342214
Alignment:
| Q |
73 |
tactctaagaaaccttcacatggaaccgcaacgtgttatcgtccttttcaccgtcatcac |
132 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||| || ||||||||||||| |
|
|
| T |
45342272 |
tactctaagaa-ccttcacatggaaccgcaacgtgttgtcgtcattgtcaccgtcatcac |
45342214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University