View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_40 (Length: 299)
Name: NF16768_low_40
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 292
Target Start/End: Complemental strand, 1834335 - 1834061
Alignment:
| Q |
18 |
aatacaaaattactaatacatagatatagataattcaaatttcttatagtaatttatcttcatgtgaggtggttcgatcatttgtgtttgtgttgattcc |
117 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1834335 |
aatacaaaattaatattacacagatatagataatacaaatttcttatagtaatttatcttcatgtgaggtggttcgatcatttgtgtttgtgttgattcc |
1834236 |
T |
|
| Q |
118 |
atggcactctgaaagcatagttccttctccttgcatttctagctgatgaagcaacggttctttctctgacattgaaagacaattgatagctttgcatatg |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1834235 |
atggcactctgaaagcatacttccttctccttgcatttctagctgatgaagcaacggttctttctctgacattgaaagataattgatagctttgcatatg |
1834136 |
T |
|
| Q |
218 |
attgtgtacttagcaactaaatccttgtaatgatttagtaatatgtccacatcttccattgctagatctctgctc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1834135 |
attgtgtacttagcaactaaatccttgtagtgatttagtaatatgtccacatcttccattgctagatctttgctc |
1834061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University