View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_41 (Length: 298)
Name: NF16768_low_41
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 12 - 174
Target Start/End: Original strand, 8344411 - 8344573
Alignment:
| Q |
12 |
atgagatatcttcatcatttgcatagctatggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtg |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8344411 |
atgagacatcttcatcatttgcatagctatggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtg |
8344510 |
T |
 |
| Q |
112 |
gagttggtgtaggacctggttctgggggtgtagttggaggtgaaaataaccccggaaatagtc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
8344511 |
gagttggtgtaggacctggttctgggggtgtagttggaggtggatataaccccggaaatagtc |
8344573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University