View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_42 (Length: 293)
Name: NF16768_low_42
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 37945809 - 37945549
Alignment:
| Q |
17 |
aatatgatatcataaaatgattggatgtgtctcaacttctcatatgattatacaaggttggagatatac--ttcaactcttcatgagttagttactcagt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
37945809 |
aatatgatatcataaaatgattggatgtgtctcaacttctcatatgattatacaaggttggagatatacttttcaactcttcatgagttagttactctgt |
37945710 |
T |
 |
| Q |
115 |
ttataggtgaggaaataacttccattcatgaataaatataacaagatgaacattaattggtaagtatgattgttcgttagcnnnnnnnaataatttattc |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37945709 |
ttataggtcaggaaataacttccattcatg----aatataacaagatgaacattaattggtaagtatgattgttcgttagctttttttaataatttattc |
37945614 |
T |
 |
| Q |
215 |
aagcttctcaaattagtttaaaatataacgaaataattgaggacgaacggtgaatgagcttcatc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37945613 |
aagcttctcaaattagtttaaaatataaagaaataattgaggactaacggtgaatgagcttcatc |
37945549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University