View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_53 (Length: 241)
Name: NF16768_low_53
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 23875359 - 23875572
Alignment:
| Q |
18 |
gattatagattcagttcttatgatatggttttagtatatgctaattgcacgttgcatcacagtttatgattatgcgattcttaatttctcaaatagaata |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
23875359 |
gattattgattcagttcttatgatatggttttagtatatgctaattgcacgttgcatcacagtttgtgattatgcgattcctaatttctcaaatagaata |
23875458 |
T |
 |
| Q |
118 |
tatgcatgtacaagcaaacaattttgaagacaaaacctataccaagcaagcaattttcaatacgccagcacccagcaggcacaccatgccagtatttacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
23875459 |
tatgcatgtacaagcaaacaattttgaagacaaaacctataccaagcaagcaattttcaatacgccagcatccag------caccatgccagtatttacc |
23875552 |
T |
 |
| Q |
218 |
ttccttatcagtattattta |
237 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
23875553 |
ttccttatcagtattcttta |
23875572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University