View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16768_low_57 (Length: 235)

Name: NF16768_low_57
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16768_low_57
NF16768_low_57
[»] chr4 (1 HSPs)
chr4 (12-221)||(51844214-51844423)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 51844423 - 51844214
Alignment:
12 tttttgttttcttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaatta 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51844423 tttttgttttcttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaatta 51844324  T
112 ccaatattggattttaattctaattatagttaaatttacaattggattgaattcattcagannnnnnngctatttttaacatcttctattcgttgaccgg 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||       ||||||||||||||||||||||||||||||||    
51844323 ccaatattggattttaattctaattatagttaaatttacaattggattcaattcattcagatttttttgctatttttaacatcttctattcgttgaccgg 51844224  T
212 ctaccttcat 221  Q
    ||||||||||    
51844223 ctaccttcat 51844214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University