View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_61 (Length: 230)
Name: NF16768_low_61
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 17283843 - 17284045
Alignment:
| Q |
15 |
gacatcatctaacatcctgcaaacctcaaattttctccacatgtaaaattaaggaatcaatttcggcacattcgtaaaatagaaggataccaacctttta |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17283843 |
gacatcatctaacatcccgcaaacctcaaattttctccacatgtaaaattaaggaatcaatttcggcacattcgtaaaatagaaggataccaacctttta |
17283942 |
T |
 |
| Q |
115 |
acactattacccggttgaaccacacaactaccaataccaacgtcaacattccactttcttgaagaagccatggaagaagcacgcgctgcctggatgacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
17283943 |
acactattacccggttgaaccacacaactaccaataccaacgtcaacatcccactttcttggagcagccatggaagaagcacgggctgcctggatgacat |
17284042 |
T |
 |
| Q |
215 |
tct |
217 |
Q |
| |
|
||| |
|
|
| T |
17284043 |
tct |
17284045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University