View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_low_66 (Length: 204)
Name: NF16768_low_66
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 24 - 188
Target Start/End: Original strand, 26493306 - 26493470
Alignment:
| Q |
24 |
caaatcccatgattgcagccacggaaaataatttccaatctcgacctagatccttctgacaccaaaattgaaaccacaacatgactaagccttctgacct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26493306 |
caaatcccatgattgcagccacggaaaataatttccaatctcgacctaggtccttctgacaccaaaattgaaaccacaacatgactaagccttctgacct |
26493405 |
T |
 |
| Q |
124 |
tatcagatgaatgaattttctgctcctcaatgggatcgtcccacacaaattctggcagccctttg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26493406 |
tatcagatgaatgaattttctgctcctcaatgggatcgttccacacaaattctggcagccctttg |
26493470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 120 - 188
Target Start/End: Original strand, 19079898 - 19079966
Alignment:
| Q |
120 |
accttatcagatgaatgaattttctgctcctcaatgggatcgtcccacacaaattctggcagccctttg |
188 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
19079898 |
accttatcagatgaatgaatttcctgctcctcaatggggtcgtcccccacaaattttggcagccctttg |
19079966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 117
Target Start/End: Original strand, 19079774 - 19079875
Alignment:
| Q |
24 |
caaatcccatgattgcagccacggaaaataatttccaatctcgacctaga--------tccttctgacaccaaaattgaaaccacaacatgactaagcct |
115 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||| |||||||| |||||| |||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
19079774 |
caaatcccatgattagagccaaggaaaatgattcccaatctcaacctagccacctacgtccttctggcaccaagattgaaaccacaacatgactaagcct |
19079873 |
T |
 |
| Q |
116 |
tc |
117 |
Q |
| |
|
|| |
|
|
| T |
19079874 |
tc |
19079875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University