View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16769_low_17 (Length: 261)
Name: NF16769_low_17
Description: NF16769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16769_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 255
Target Start/End: Original strand, 27543408 - 27543646
Alignment:
| Q |
16 |
atgaagaaggatggcaaattgtttgtcgtaaaaggaaacaacccatnnnnnnnnnnnnnnnntttgattttgatgcattcactgttcatgcgtgacttat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
27543408 |
atgaagaaggatggcaaattgtttgtcgtaaaaggaaacaacccataaaaaaataaaataatttt-attttgatgcattcactgttcatgtgtgacttat |
27543506 |
T |
|
| Q |
116 |
catcctcagctaccgctaggtactgcatctaagtggattgattaaaaataaatacatgggtttaaaatttatttcatccgttcatgtgccctttaccatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
27543507 |
catcctcagctaccgctaggtactgcatctaagtggattgattaaaaataaatacatgggtttaaaattaatttcatccgttcatgtgtcctttaccatg |
27543606 |
T |
|
| Q |
216 |
ttcatgtgttagttaggtagctaatgaaattgagactttc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27543607 |
ttcatgtgttagttaggtagctaatgaaattgagattttc |
27543646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University