View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16769_low_21 (Length: 239)

Name: NF16769_low_21
Description: NF16769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16769_low_21
NF16769_low_21
[»] chr5 (1 HSPs)
chr5 (1-152)||(27544326-27544473)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 27544326 - 27544473
Alignment:
1 tatgtatgtggatgtccatttaacttgaatcttgcaaacctagaatgacaattattgtatcccatggactatttaaggttctatgatacattaagaaatt 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||    ||||    
27544326 tatgtatgtgaatgtccatttaacttgaatcttgcaaacctagaatgacaattattgtatcccatagacaatttaaggttctatgacacatt----aatt 27544421  T
101 gaagaattttaatacatttgtattcgaaaccaataaactaactattgtttta 152  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||    
27544422 gaagaattttaacacatttgtattcgaaaccaataaactaactattgtttta 27544473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University