View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16769_low_25 (Length: 201)
Name: NF16769_low_25
Description: NF16769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16769_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 3720648 - 3720761
Alignment:
| Q |
18 |
caaagggtgacaggaaaataaccttgaaagcaacatagctatctgtcttatttgataattgaagagaacacgagatctgtttcttgagctcaactgaaac |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3720648 |
caaagagtgacaggaaaataaccttgaaagcaacatagctatctgtcttatttgataattgaagagaacacgagatctgtttcttgagctcaactgaaac |
3720747 |
T |
 |
| Q |
118 |
agagaatgatcatg |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3720748 |
agagaatgatcatg |
3720761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 38 - 120
Target Start/End: Complemental strand, 41712835 - 41712753
Alignment:
| Q |
38 |
accttgaaagcaacatagctatctgtcttatttgataattgaagagaacacgagatctgtttcttgagctcaactgaaacaga |
120 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| || ||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
41712835 |
accttgaaagctacatagctatcagtcttattagacaattgaagagaacacgagatctgcttcttcagctcaactgcaacaga |
41712753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University