View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1677-Insertion-2 (Length: 281)
Name: NF1677-Insertion-2
Description: NF1677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1677-Insertion-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 7 - 196
Target Start/End: Original strand, 35702584 - 35702773
Alignment:
| Q |
7 |
aagtcctcggtctgtgaacagtccaagaagaacactgagtctttcaagaaagcggagggcaactgtgtcatttcttgattccgatgacaaaaacaactct |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35702584 |
aagtcctcggtctgtcaacagtccaagaagaacactgagtctttcaagaaagcggagggcgactgtgtcatttcttgattccgatgacaaaaacaactct |
35702683 |
T |
|
| Q |
107 |
gcctctgctttgtctgctgatcatggccctaaaccttctaaagtttacggtttcgttggatctataactaccgttgttgctacaggtttt |
196 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35702684 |
gcctctgctttgtcagctgatcatggccctaaaccttctgaagtttacggttttgttggatctataactaccgttgttgctacaggtttt |
35702773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 7 - 196
Target Start/End: Original strand, 7955464 - 7955653
Alignment:
| Q |
7 |
aagtcctcggtctgtgaacagtccaagaagaacactgagtctttcaagaaagcggagggcaactgtgtcatttcttgattccgatgacaaaaacaactct |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7955464 |
aagtcctcggtctgtcaacagtccaagaagaacactgagtctatcgagaaagcggagggcaactgtgtcatttctcgattccgatgataaaaacaactct |
7955563 |
T |
|
| Q |
107 |
gcctctgctttgtctgctgatcatggccctaaaccttctaaagtttacggtttcgttggatctataactaccgttgttgctacaggtttt |
196 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7955564 |
gcctctggtttgtcaagggatcatggccctaagccttctgaagtttacggtttcgttggatctataactaccgttgttgctacaggtttt |
7955653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 228 - 281
Target Start/End: Original strand, 35702925 - 35702979
Alignment:
| Q |
228 |
ttcctgtggcattttgtt-atttatactttgttcgttttcctttgtgaatagtta |
281 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35702925 |
ttcctgtggcattttttttatttatactttgttcattttcctttgtgaatagtta |
35702979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University