View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1677-Insertion-7 (Length: 91)
Name: NF1677-Insertion-7
Description: NF1677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1677-Insertion-7 |
 | |
|
| [»] chr6 (5 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 5e-19; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 24384851 - 24384934
Alignment:
| Q |
8 |
gagtgcatggttcgatactccaacacctctttcttttccactgttgcaatacgtcctgggttttccatgttgaacgtaggcaac |
91 |
Q |
| |
|
||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||| ||| ||||| ||||| ||||||| |
|
|
| T |
24384851 |
gagtgcatggttcaatactccaactattatttcttttccactgttgcaatacgtcctgggctttacatgtggaacgcaggcaac |
24384934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 20128232 - 20128174
Alignment:
| Q |
8 |
gagtgcatggttcgatactccaacacctctttcttttccactgttgcaatacgtcctgg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
20128232 |
gagtgcatggttcgatactccaacacctctttcttttccactgtttctacacgtcctgg |
20128174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 22204638 - 22204696
Alignment:
| Q |
8 |
gagtgcatggttcgatactccaacacctctttcttttccactgttgcaatacgtcctgg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
22204638 |
gagtgcatggttcgatactccaacacctctttcttttccactgtttctacacgtcctgg |
22204696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 20205845 - 20205805
Alignment:
| Q |
8 |
gagtgcatggttcgatactccaacacctctttcttttccac |
48 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
20205845 |
gagtgcatggttcgatactctaacatatctttcttttccac |
20205805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 22099868 - 22099828
Alignment:
| Q |
8 |
gagtgcatggttcgatactccaacacctctttcttttccac |
48 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
22099868 |
gagtgcatggttcgatactctaacatatctttcttttccac |
22099828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 47634906 - 47634946
Alignment:
| Q |
8 |
gagtgcatggttcgatactccaacacctctttcttttccac |
48 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
47634906 |
gagtgcatggttcgatattccaacacctcttttttctccac |
47634946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University