View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16770_low_11 (Length: 273)
Name: NF16770_low_11
Description: NF16770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16770_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 25555555 - 25555300
Alignment:
| Q |
1 |
atgtctcccttgccttggtgggaatggttaatggtgtcagtaatgtatcagtgtccttttttcatctaccaaaatgaaatgtaactccaaatttgatggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25555555 |
atgtctcccttgccttggtgggaatggttaatggtgtcagtaatgtatcagtgtccttttttcatctaccaaaatgaaatgtaactccaaatttgatggc |
25555456 |
T |
|
| Q |
101 |
tagacgcaactctaatgtctaaactattgaatggacaatgaccactctgccacgtaatcatctttcatttatttcttgactttatgttgctttggttttt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25555455 |
tagacgctgctctaatgtctaaactattgaatggacaatgaccactctgccacgtaatcatctttcatttatttcttggctttatgttgctttggttttt |
25555356 |
T |
|
| Q |
201 |
gaaacatcacatttaaactatttggtgcccataattgtgaggtaacatgtggttag |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25555355 |
gaaacatcacatttaaactatttggtgcccataattgtgaggtaacatgtggttag |
25555300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University