View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16770_low_14 (Length: 248)
Name: NF16770_low_14
Description: NF16770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16770_low_14 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 34479401 - 34479172
Alignment:
| Q |
19 |
cttacagtaagagtgtggtgacaattatcagaaatcaacctactaacaaatatcctctnnnnnnnncctatatttgatatctcgatttaaaaccccggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
34479401 |
cttacagtaagagtgtggtgacaattatcagaaatcaacctactaacaaatatcctctaaaaaaaacctatatttgatttctcgatttaaaaccccggtt |
34479302 |
T |
|
| Q |
119 |
tgattaaaagaaaaaacattgaattaaaaagcttacatcaagtttataacaaaaatgcttttagaataaaatacctaatcatacatcattttagtcccaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34479301 |
tgattaaaagaaaaaacattgaattaaaaagcttacatcaagtttataacaaaaatgcttttagattaaaatacctaatcatacatcattttagtcccaa |
34479202 |
T |
|
| Q |
219 |
ccctattttaaacaagttatttttgactgc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34479201 |
ccctattttaaacaagttatttttgactgc |
34479172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University