View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16771_high_3 (Length: 305)
Name: NF16771_high_3
Description: NF16771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16771_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 44171552 - 44171252
Alignment:
| Q |
1 |
tcatcagttttacacactcattaacaggctcaatatggtcattgatgcnnnnnnntgcatgaaatttgatagagcagctttaataacgatataatataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44171552 |
tcatcagttttacacactcattaacaggctcaatatgatcattgatgcaaaaaaatgcatgaaatttgatagagcagctttaataacgatataatataaa |
44171453 |
T |
 |
| Q |
101 |
cctgtgaaagcctagatactgattgtgatttagtgnnnnnnnnnnnnnnnn-gaagtggtgatagtagcagtttgcctgtgtgatcaattaatgaagtga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44171452 |
cctgtgaaagcctagatactgattgtgatttagtgtttttttttttttttttgaagtggtgatagtagcagtttgcctgtgtgatcaattaatgaagtga |
44171353 |
T |
 |
| Q |
200 |
aattgaacacttttcacagcatttagtgatatacagattttggcattctactcttgctgacagtagcaagtagaagcaattataaagcaccctatgattc |
299 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44171352 |
agttgcacacttttcacagcatttagtgatatacagattttggcattctactcttgctgacagtagcaagtagaagcaattataaagcaccccatgattc |
44171253 |
T |
 |
| Q |
300 |
t |
300 |
Q |
| |
|
| |
|
|
| T |
44171252 |
t |
44171252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University