View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16772_high_20 (Length: 235)
Name: NF16772_high_20
Description: NF16772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16772_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 12531419 - 12531636
Alignment:
| Q |
1 |
aggaagtgtgctgagatggctggaatggctgtacagattgttgtgtcagctgttttgggagatccaacggttcttattgctgggattatggggtcgttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12531419 |
aggaagtgtgctgagatggctggaatggctgtacagatcgttgtctcagctgttttgggagatccaacggttcttattgctgggattatggggtcgttga |
12531518 |
T |
 |
| Q |
101 |
tatcgcgatcttgatcttgtggtggatggtagttcattgtattgtatcaaatatctgctactgtgaaaaatgtaagtggaatatttgtgtatcaatttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12531519 |
tatcgcgatcttgatcttgtggtggatggtagttcattgtattgtatcaaatatctgctattgtgaaaaatgtcagtggaatatttgtgtatcaatttca |
12531618 |
T |
 |
| Q |
201 |
atgaatatatattcatat |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12531619 |
atgaatatatattcatat |
12531636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 52 - 208
Target Start/End: Original strand, 12533537 - 12533693
Alignment:
| Q |
52 |
gttttgggagatccaacggttcttattgctgggattatggggtcgttgatatcgcgatcttgatcttgtggtggatggtagttcattgtattgtatcaaa |
151 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||| |||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
12533537 |
gttttgggagagccaacggttcttattgctgggattatggggtcattgatgtcacgagcttgatcttgtggtcgatggtagttcattgtattgtatcaga |
12533636 |
T |
 |
| Q |
152 |
tatctgctactgtgaaaaatgtaagtggaatatttgtgtatcaatttcaatgaatat |
208 |
Q |
| |
|
| | ||||| ||||| ||||||||||| ||||||||||||| ||||| |||| |||| |
|
|
| T |
12533637 |
tgtatgctattgtgataaatgtaagtgaaatatttgtgtattaatttgaatgtatat |
12533693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University