View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16772_high_21 (Length: 230)
Name: NF16772_high_21
Description: NF16772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16772_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 100 - 211
Target Start/End: Complemental strand, 14710862 - 14710748
Alignment:
| Q |
100 |
atttaatcagttatgcatgtgttacgcagcttgtggaagacgtatcttttttggaccttaag---taagtttttcttaaagggtctgaagctctaccatc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||| || | ||||||| |
|
|
| T |
14710862 |
atttaatcagttatgcatgtgttacgcagcttgtggaaaacgtatcttttttggaccttaagcaataagtttttcttaaaggatctgcagttttaccatc |
14710763 |
T |
|
| Q |
197 |
tctctgaggatcttg |
211 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14710762 |
tctctgaggatcttg |
14710748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University