View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16772_low_17 (Length: 291)
Name: NF16772_low_17
Description: NF16772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16772_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 272
Target Start/End: Original strand, 15904929 - 15905188
Alignment:
| Q |
14 |
atatctataatgaaaggaaatgttttaaatagaaaaatctacacattgcttaattatcataaacatacaaggattgtgtggaccttatatttatctggat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15904929 |
atatctataatgaaaggaaatgttttaaatagaaaaatctacacattgcttaattatcataaacatacaaggattgtgtggaccttatatttatctggat |
15905028 |
T |
|
| Q |
114 |
cacaattttggaatcttttaag-nnnnnnnnggatttttaaaatttattactgaaagtccttcttcacccttcatctgttggatgaaaatgatgctgcat |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15905029 |
cacaattttggaatcttttaagattatttttggatttttaaaatttattactgaaagtccttcttcacccttcatctgttggatgaaaatgatgctacat |
15905128 |
T |
|
| Q |
213 |
tgtgggggcaagtttcttttctttcaatcctgatttttatgttttcttcaaataactacc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15905129 |
tgtgggggcaagtttcttttctttcaatcctgatttttatgtttttttcaaataactacc |
15905188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University