View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16772_low_21 (Length: 238)
Name: NF16772_low_21
Description: NF16772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16772_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 4996423 - 4996614
Alignment:
| Q |
1 |
cccttacactctacctttggctgtgtcttgttcttcacttatggtttctcatgcaaaattcttattgctttcaagtattcactttttcaacttttcaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
4996423 |
cccttacactctacctttggctgtgtcttgttcttcacttatggtttctcatgcaaaattcttattgatttcaagtaatcactttttcaacttttcaaaa |
4996522 |
T |
 |
| Q |
101 |
gaatccaaatcttaatcacgtttccccctccactttcaaacctttttccaaccgttcatcattgattgcacacttttctccataataatccc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4996523 |
gaatccaaatcttaatcacgtttccccctccactttcaaacctttttccaaccgttcatcattgattgcacacttttctccataataatccc |
4996614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University