View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16772_low_23 (Length: 230)

Name: NF16772_low_23
Description: NF16772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16772_low_23
NF16772_low_23
[»] chr8 (1 HSPs)
chr8 (100-211)||(14710748-14710862)


Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 100 - 211
Target Start/End: Complemental strand, 14710862 - 14710748
Alignment:
100 atttaatcagttatgcatgtgttacgcagcttgtggaagacgtatcttttttggaccttaag---taagtttttcttaaagggtctgaagctctaccatc 196  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||   ||||||||||||||||| |||| || | |||||||    
14710862 atttaatcagttatgcatgtgttacgcagcttgtggaaaacgtatcttttttggaccttaagcaataagtttttcttaaaggatctgcagttttaccatc 14710763  T
197 tctctgaggatcttg 211  Q
    |||||||||||||||    
14710762 tctctgaggatcttg 14710748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University