View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16773_high_9 (Length: 291)
Name: NF16773_high_9
Description: NF16773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16773_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 12 - 275
Target Start/End: Complemental strand, 14162081 - 14161818
Alignment:
| Q |
12 |
atgaaaagtgctagaatatcaaccgtgtccggtatatctacaatcaaatcatcagccgattcgactaatttggtgaatcctttgtaaacttgtgaaggat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14162081 |
atgaaaagtgctagaatatcaaccgtgtccggtatatctacaatcaaatcatcagccgattcgactaatttggtgaatcctttgtaaacttgtgaaggat |
14161982 |
T |
 |
| Q |
112 |
gaattatgtcagcataaagtgcagataagagaattgcagccatttctttttctttgtcgtgtctgtccattgacattgagacaagctttttgacaaaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14161981 |
gaattatgtcagcataaagtgcagataagagaattgcagccatttctttttctttgtcgtgtctgtccattgacattgagacaagctttttgacaaaata |
14161882 |
T |
 |
| Q |
212 |
gtagctgtattctggtttaccaatttctctaacttcactcattgttgcgacaacgtcgtctgtg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14161881 |
gtagctgtattctggtttaccaatttctctaacttcactcattgttgcgacaacgtcgtctgtg |
14161818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University