View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16773_low_13 (Length: 216)
Name: NF16773_low_13
Description: NF16773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16773_low_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 39212170 - 39212370
Alignment:
| Q |
16 |
gacggtcgaggagagttaactgaaccggaagtgaaccggtgaggttgttatgagagagtgaaagagtgatgagtctatggaggaagagaatggaaggagg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39212170 |
gacggtcgaggagagttaactgaaccggaagtgaaccagtgaggttgttatgagagagtgaaagagtgatgagtctatggaggaagagaatggaaggagg |
39212269 |
T |
|
| Q |
116 |
gaatgaaccggagaaattattccggtcgaggaagagtgatttgaggtttgtaagtggagaaagatctggaataggtccagagagcgagttgttacggagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39212270 |
gaatgaaccggagaaattattccggtcgaggaagagtgatttgaggtttgtaagtggagaaagatctggaataggtccagagagcgagttgttacggagg |
39212369 |
T |
|
| Q |
216 |
c |
216 |
Q |
| |
|
| |
|
|
| T |
39212370 |
c |
39212370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University