View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16773_low_14 (Length: 213)
Name: NF16773_low_14
Description: NF16773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16773_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 22 - 151
Target Start/End: Original strand, 45645297 - 45645426
Alignment:
| Q |
22 |
tagatatttgttatttcaaattggtgacatccactctttatttgagtatgctccttggctaggtaataatccctctgtcatcatgtggattatgtagata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45645297 |
tagatatttgttatttcaaattggtgacatccaccctttatttgagtatgctccttggctaggtaataatccctttgtcatcatgtggattatgtagata |
45645396 |
T |
|
| Q |
122 |
ttctggacacccatattagaattaaagatg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45645397 |
ttctggacacccatattagaattaaagatg |
45645426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 73 - 199
Target Start/End: Original strand, 51917869 - 51917995
Alignment:
| Q |
73 |
tccttggctaggtaataatccctctgtcatcatgtggattatgtagatattctggacacccatattagaattaaagatgtctattctgttgatggttgac |
172 |
Q |
| |
|
|||| |||| ||||||||| || | |||||| || |||||||||| ||| | |||||||||| |||||| ||||||||||||||| | ||||||| | |
|
|
| T |
51917869 |
tcctaggcttggtaataattcccatttcatcacgttgattatgtagctatacaagacacccataatagaatcaaagatgtctattctacttatggttggc |
51917968 |
T |
|
| Q |
173 |
agctaaatcaattatacatttcttttt |
199 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
51917969 |
agctaaatcaattatacacttcttttt |
51917995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University