View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16773_low_2 (Length: 510)
Name: NF16773_low_2
Description: NF16773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16773_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 262 - 493
Target Start/End: Complemental strand, 12920371 - 12920140
Alignment:
| Q |
262 |
gaacattgggttgcatatacctaagggaaaacccctccattttcgtcccaccggtgacatggacttgacagatttggaagtttaagtttgtgcttatcta |
361 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920371 |
gaacattgggttgcttatacctaagggaaaacccctccattttcgtcccaccggtgacatggacttgacagatttggaagtttaagtttgtgcttatcta |
12920272 |
T |
 |
| Q |
362 |
tttcagaaaacaaaggaacccaaacttattgaggagaggttggtgaaggccggtgaactatctgccaatagagatgaattgatgtctttactcccaacta |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12920271 |
tttcagaaaacaaaggaacccaaacttattgaggagaggttggtgaaggccggtgaactatctgccaatagagatgaattgatgtttttactcccaacta |
12920172 |
T |
 |
| Q |
462 |
aagttgtttctgagttggtaatgtgttaaaat |
493 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
12920171 |
aagttgtttctgagttggtaatgtgtttaaat |
12920140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 40 - 196
Target Start/End: Complemental strand, 12920593 - 12920437
Alignment:
| Q |
40 |
taggattgttgcacgtgcagaccataagcaaataattaacaaatatgatatggctaaacttaatatatttgtgtgctctatacagctctcacctgttgca |
139 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920593 |
taggattgttgcaggtgcagaccataagcaaataattaacaaatatgatatggctaaacttaatatatttgtgtgctctatacagctctcacctgttgca |
12920494 |
T |
 |
| Q |
140 |
aagactcccactaagcctaagaggcttttccattctcaatcaccccctgctagtggt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920493 |
aagactcccactaagcctaagaggcttttccattctcaatcaccccctgctagtggt |
12920437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University