View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16774_low_16 (Length: 303)
Name: NF16774_low_16
Description: NF16774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16774_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 4 - 289
Target Start/End: Complemental strand, 33791189 - 33790904
Alignment:
| Q |
4 |
agatggacatcatcaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgcta |
103 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33791189 |
agatgtacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaacagaatctcttgttgcta |
33791090 |
T |
|
| Q |
104 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791089 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
33790990 |
T |
|
| Q |
204 |
tcttgctgctttctctgattcattgcccttctttgagtctattaatatggatgcgtcacacccctgaaattaactcaaccaaattg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33790989 |
tcttgctgctttctctgattcattgcccttctttgagtctattaatatggatgcgtcacacccctgaaattaaatcaaccaaattg |
33790904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 144
Target Start/End: Original strand, 33764098 - 33764212
Alignment:
| Q |
30 |
taatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgctaatgatattatgtctgcacatgaaact |
129 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| ||||||| || | |||| | || | ||||||||| || | || || ||||||||||||||||| |
|
|
| T |
33764098 |
taatccgtcacgtcttcctgtaggaatattgtattttggtcctccagataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaacc |
33764197 |
T |
|
| Q |
130 |
gttgatggacatgca |
144 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33764198 |
gttgatggacatgca |
33764212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University