View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16774_low_21 (Length: 237)
Name: NF16774_low_21
Description: NF16774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16774_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 22382678 - 22382870
Alignment:
| Q |
15 |
aatatcatagctattagttgcgcattagttaagaaaatattttgttagatgatttacgtagctaaatcttgctagagactaaccacatattttacagagc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22382678 |
aatatcatagctattagttgcgcattagttaagaaaatattgt---------------tagctaaatcttgctagagactaaccacatattttacagagc |
22382762 |
T |
 |
| Q |
115 |
taatcccatattttcttgtagtggctttcaaggatggtagttcgaaaagctattaagagcatgaaacaa-nnnnnnnnacaacatcaattgaattttata |
213 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22382763 |
taatcccatattttgttatagtggctttcaaggatggtagttcgaaaagctattaagagcacgaaacaatttttttttacaacatcaattgaattttata |
22382862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University