View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16775_high_4 (Length: 280)
Name: NF16775_high_4
Description: NF16775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16775_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 175 - 272
Target Start/End: Complemental strand, 14746202 - 14746105
Alignment:
| Q |
175 |
aatatatattcagctggagccacataacctttcagagaggtgcttttctttctctaaatctaaatattcaagaactccaaaacttaaggtgttcttct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14746202 |
aatatatattcagctggagccacataaccttttagagaggtgcttttgtttctctaaatctaaatattcaagaattccaaaacttaaggtgttcttct |
14746105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 159 - 267
Target Start/End: Complemental strand, 14743179 - 14743080
Alignment:
| Q |
159 |
atgatgttacttaataaatatatattcagctggagccacataacctttcagagaggtgcttttctttctctaaatctaaatattcaagaactccaaaact |
258 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||| |||| ||||||||||||| ||||||||||||||||||||||| | |||||||||| |
|
|
| T |
14743179 |
atgatgttaattaataaatatttattcagcaggagcgacat---------gagaggtgcttttgtttctctaaatctaaatattcaaaatctccaaaact |
14743089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 127
Target Start/End: Complemental strand, 14746886 - 14746852
Alignment:
| Q |
93 |
cagtagcagagagctaagaagaaacactcttaaat |
127 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
14746886 |
cagtagcagagagctaagaagaaaaactcttaaat |
14746852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University