View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16775_low_2 (Length: 476)
Name: NF16775_low_2
Description: NF16775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16775_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 232 - 461
Target Start/End: Original strand, 40311434 - 40311664
Alignment:
| Q |
232 |
ttccaactggttatatccatgtcagagcaagaaggggtcaggcaacagatagccacagccttgctgaaagggtatgcaatacagtttttacctatgaagc |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311434 |
ttccaactggttatatccatgtcagagcaagaaggggtcaggcaacagatagccacagccttgctgaaagggtatgcaatacagtttttacctatgaagc |
40311533 |
T |
 |
| Q |
332 |
cctaacagggacacaaacgccgaatgtaataacatg-tgttaatgtgtagccggacaaaagtgtcggagctacttaggttattacaatttacaactgaaa |
430 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311534 |
cctaacacggacacaaacgccgaatgtaataacatgccgttagtgtgtagccggacaaaagtgtcggagctacttaggttattacaatttacaactgaaa |
40311633 |
T |
 |
| Q |
431 |
gggaattcctcaattgcctcaaagttcatgt |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40311634 |
gggaattcctcaattgcctcaaagttcatgt |
40311664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 76 - 124
Target Start/End: Original strand, 40311278 - 40311326
Alignment:
| Q |
76 |
tgtttcatgttattgattttgttactttgtggtatttgtaggatatctc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311278 |
tgtttcatgttattgattttgttactttgtggtatttgtaggatatctc |
40311326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 30 - 63
Target Start/End: Original strand, 40311217 - 40311250
Alignment:
| Q |
30 |
ctaaggtaaatttgatgcagttttctttaccccc |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40311217 |
ctaaggtaaatttgatgcagttttctttaccccc |
40311250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 234 - 305
Target Start/End: Original strand, 45175752 - 45175823
Alignment:
| Q |
234 |
ccaactggttatatccatgtcagagcaagaaggggtcaggcaacagatagccacagccttgctgaaagggta |
305 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
45175752 |
ccaactggctatatccacgtccgagcaagaaggggtcaggccactgatagccacagccttgctgaaagggta |
45175823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University