View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16776_high_12 (Length: 283)
Name: NF16776_high_12
Description: NF16776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16776_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 39705236 - 39704974
Alignment:
| Q |
1 |
ttgcttgcaggagttataaggtaaaatatgttaaacagtacaattannnnnnnnnnnnnnnncaccaaatcaatcctgctgttgctaatcactaaccata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39705236 |
ttgcttgcaggagttataaggtaaaatatgttaaacagtacaattattttttgggcttttttcaccaaatcaatcatgctgttgctaatcactaaccata |
39705137 |
T |
 |
| Q |
101 |
agcttgggacttttccattttttcaaaatttattcaatattctgtaattctgaattttagatattatatgttatttttggaatggtgatgcactttattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39705136 |
agcttgggacttttccattttttcaaaatttattcaatattctgtaattctgaattttagatattatatgttatttttggaatggtgatgcactttattt |
39705037 |
T |
 |
| Q |
201 |
gcaggtcatgcagattggatgttgaaactcaccaacatgagtgcacctttctcatgttgcagg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39705036 |
gcaggtcatgcagattggatgttgaaactcaccagcatgagtgcacctttctcatgttgcagg |
39704974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 165 - 264
Target Start/End: Original strand, 21993659 - 21993758
Alignment:
| Q |
165 |
tatatgttatttttggaatggtgatgcactttatttgcaggtcatgcagattggatgttgaaactcaccaacatgagtgcacctttctcatgttgcagga |
264 |
Q |
| |
|
||||| ||||| |||| ||| | ||||| ||||||| |||||||| ||||||||||| |||| ||||| || ||||||||||||||||||| |||||||| |
|
|
| T |
21993659 |
tatatattattgttggcatgataatgcattttatttacaggtcatacagattggatgctgaacctcacaaatatgagtgcacctttctcatattgcagga |
21993758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 136 - 266
Target Start/End: Original strand, 15527520 - 15527653
Alignment:
| Q |
136 |
aatattctgtaattctgaattttagatattatatgttatttttggaatggtgatgcactttatttgcaggtcatgcagattggatgttgaaactcaccaa |
235 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| |||| |||||||| |||| ||||||| ||||| ||||| |||||||||| | ||||||||||| |
|
|
| T |
15527520 |
aatattctgtaattcagatttttagatattatattctattgttggaatgatgatacacttta-ttgcaagtcatccagattggatactaaaactcaccaa |
15527618 |
T |
 |
| Q |
236 |
----catgagtgcacctttctcatgttgcaggata |
266 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
15527619 |
tatttatgagtgcacctttctcatgttgcatgata |
15527653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University