View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16777_low_3 (Length: 480)
Name: NF16777_low_3
Description: NF16777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16777_low_3 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 31 - 267
Target Start/End: Original strand, 7674 - 7911
Alignment:
| Q |
31 |
tatcttttgaaagagagcaaatgctcttgaannnnnnnn-gagagctctgtccaatgaatgttgaaaacaatcgatcagttgaaaatgtagtacgtgttg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7674 |
tatcttttgaaagagagcaaatgctcttgaaattttttttgagagctctgtccaatgaatgttgaaaacaatcgatcagttgaaaatgtagtacgtgttg |
7773 |
T |
|
| Q |
130 |
tctgacaaataatgacaatgaatatggcaaattgttcttgacaactcaagaacctagtgtctttaatttttcttttatcctttcttttaacagcttgcat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7774 |
tctgacaaataatgacaatgaatatggcaaattgttcttgacaactcaagaacctagtgtctttaatttttcttttatcctttcttttaacagcttgcat |
7873 |
T |
|
| Q |
230 |
tagttaatagtaaattaagatgatgtcatgcgaaatgt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7874 |
tagttaatagtaaattaagatgatgtcatgcgaaatgt |
7911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University