View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16778_low_12 (Length: 274)
Name: NF16778_low_12
Description: NF16778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16778_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 4 - 269
Target Start/End: Complemental strand, 42546684 - 42546419
Alignment:
| Q |
4 |
ggtaaataatacttctgagtataaattctatctatattcttatgactacttccataacgcgctcttcacctctaatcccaat----gtaaggaaagtcaa |
99 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42546684 |
ggtatatactacttctgagtataaattctat----attcttatgactacttccataacgcgctcttcacctctaatcccaatcaatgtaaggaaagtcaa |
42546589 |
T |
|
| Q |
100 |
atgttagtgatcattcaagtaattgaatggtttattgtttattgatgtaatgttccaatatattgaatcagcaatcatgcctttagcttgacaattatac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42546588 |
atgttagtgatcattcaagtaattgaatggtttattgtttattgatgtaatgttccaatatattgaatcagcgatcatgcctttagcttgacaattatac |
42546489 |
T |
|
| Q |
200 |
acggaacaatggatattttagaagagtgatattcttgatgtggaactgataaaatatcaaagtcatattt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546488 |
acggaacaatggatattttagaagagtgatattcttgatgtggaactgataaaatatcaaagtcatattt |
42546419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University