View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16779_low_6 (Length: 228)
Name: NF16779_low_6
Description: NF16779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16779_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 126 - 213
Target Start/End: Complemental strand, 798298 - 798211
Alignment:
| Q |
126 |
ataacacaattggacacttattgttggtatagttgtttgactactgtttacacgaggcaaaacactagaaagtcagatgctttaattg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
798298 |
ataacacaattggacacttattgttggtatagttgtttgactactgtttacacgtggcaaaacaccagaaagtcagatgctttaattg |
798211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 798427 - 798356
Alignment:
| Q |
1 |
tatatatttgtctctattttgtaaattttgctaggcaagcctaagtc----atctagcgagccaaacttaac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
798427 |
tatatatttgtctctattttgtaaattttgctaggcaagcctaagtcatcgatctagcgagccaaacttaac |
798356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 191
Target Start/End: Original strand, 14527408 - 14527454
Alignment:
| Q |
145 |
attgttggtatagttgtttgactactgtttacacgaggcaaaacact |
191 |
Q |
| |
|
||||||||||||||||||||| |||||| || |||| |||||||||| |
|
|
| T |
14527408 |
attgttggtatagttgtttgattactgtgtatacgatgcaaaacact |
14527454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University