View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1677_high_20 (Length: 233)
Name: NF1677_high_20
Description: NF1677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1677_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 67 - 218
Target Start/End: Complemental strand, 17053319 - 17053167
Alignment:
| Q |
67 |
gagattgatgagattttctttaaaaccacatttaaggttttaataatcgaaatcttttccttannnnnnnncttgnnnnnnnnnnngttaatggatcgga |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
17053319 |
gagattgatgagattttctttaaaaccacatttaaggttttaataatcgaaatattttccttattttttttcttgaaaaaaaaaaagttaatggatcgga |
17053220 |
T |
 |
| Q |
167 |
tg-ctgcaccttccacctgctgcacaaccaatctgattcaaacaaaaatttaa |
218 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
17053219 |
tgcctgcaccttccaccagctgcacaaccaatctcattcaaacaaaaatttaa |
17053167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University