View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1677_low_13 (Length: 244)
Name: NF1677_low_13
Description: NF1677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1677_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 9945951 - 9946183
Alignment:
| Q |
1 |
tccaccttctccctctccataccaccctacagtcattgtcattgtcatcattgcatttggcggcattgccttgctctccatgcttgcttttgcattattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945951 |
tccaccttctccctctccataccaccctacagtcattgtcattgtcatcattgcatttggtggcattgccttgctctccatgcttgcttttgcattattt |
9946050 |
T |
 |
| Q |
101 |
tgctgcgttcaaaagaggaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |||||||| ||||||||||||||| ||||| |
|
|
| T |
9946051 |
tgctgcgttcaaaagaggaagaagaaacaagaaaccgatgtcattcatatcgatgaacataaaaagattacggaaaacattgtgcctggtccttttggac |
9946150 |
T |
 |
| Q |
201 |
aaccactggtggtggttacagttgaagatgatg |
233 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
9946151 |
aaccaacggtggtggttacagttgaagatgatg |
9946183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 203
Target Start/End: Complemental strand, 1022214 - 1022129
Alignment:
| Q |
118 |
gaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaac |
203 |
Q |
| |
|
|||||||| |||||||||||||||| | || ||| |||| ||||||||| || ||||| ||||| ||||||||| |||||||| |
|
|
| T |
1022214 |
gaagaagacacaagaaaccgatatcatacacatcgatgagcataaaaagggcaaggaaaccattgtacctggtccttttggacaac |
1022129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University