View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1677_low_18 (Length: 236)

Name: NF1677_low_18
Description: NF1677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1677_low_18
NF1677_low_18
[»] chr1 (2 HSPs)
chr1 (10-104)||(30897591-30897685)
chr1 (184-221)||(30897428-30897465)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 30897685 - 30897591
Alignment:
10 aatttaagttcttgaacatattacaaaattcataattaatttatgtnnnnnnnttgataaatggtattttgatgtcaaataatatacgctcatcc 104  Q
    |||||||||||||||| |||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||    
30897685 aatttaagttcttgaatatattacaaaattcataattaatttatgtaaaaattttgataaatggtattttgatgtcaaataatatacgctcatcc 30897591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 30897465 - 30897428
Alignment:
184 aagcaactcatatttctcttaatcatggaggtataaat 221  Q
    ||||||||||||||||||||||||||| || |||||||    
30897465 aagcaactcatatttctcttaatcatgtagttataaat 30897428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University