View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1677_low_18 (Length: 236)
Name: NF1677_low_18
Description: NF1677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1677_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 30897685 - 30897591
Alignment:
| Q |
10 |
aatttaagttcttgaacatattacaaaattcataattaatttatgtnnnnnnnttgataaatggtattttgatgtcaaataatatacgctcatcc |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897685 |
aatttaagttcttgaatatattacaaaattcataattaatttatgtaaaaattttgataaatggtattttgatgtcaaataatatacgctcatcc |
30897591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 30897465 - 30897428
Alignment:
| Q |
184 |
aagcaactcatatttctcttaatcatggaggtataaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
30897465 |
aagcaactcatatttctcttaatcatgtagttataaat |
30897428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University