View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_high_32 (Length: 344)
Name: NF16780_high_32
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_high_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 40 - 312
Target Start/End: Complemental strand, 1792324 - 1792052
Alignment:
| Q |
40 |
tttgtccctagaaaatttgctaatacaaaaaactaatcatatagttcttttgtgataatttctcaatctgcctgtgcgaccccattagctatcgaaaggt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1792324 |
tttgtccctagaaaatttgctaatacaaaaaactaatcatatagttcttttgtgataatttctcaatctgcctgtatgaccccattagctatcgaaaggt |
1792225 |
T |
|
| Q |
140 |
cctttcaataatatattttagccgaaataatatcgaaaggatccattcgatagtgtattttgagggcctatgagcatataagagggtgaattgagaaatt |
239 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1792224 |
cctttcaataatgtattttatccgaaataatatcgaaaggatccttccgatagtgtattttgggggcctatgagcatataagggggtgaattgagaaatt |
1792125 |
T |
|
| Q |
240 |
atattttcataattttagaattatgttgagcagggttttaataggcccattaatgccttttccctagagaatt |
312 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1792124 |
atatttttataattttagaattatgttgagcagggttttaataggcccattgatgccttttccttagagaatt |
1792052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University