View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_high_35 (Length: 328)
Name: NF16780_high_35
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 11 - 312
Target Start/End: Complemental strand, 51671649 - 51671346
Alignment:
| Q |
11 |
atcatcaggtttcgctatggaacaagtgtttagaagtgaaaacaatgattgcatcatatacaagttttgtgaggtgatctgagattagatcacaaattct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51671649 |
atcatcaggtttcgctatggaacaagtgtttagaagtgaaaacaatgattgcatcatatacaagttttgtgaggtgatctgagattagatcacaaattct |
51671550 |
T |
 |
| Q |
111 |
aagaacaacttatagtgtttgtgtcatattgttgagaaacgacttcgatccctagaaaggtcggtaaaaaagacg--agaggtattaaaaagtgataatg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51671549 |
aagaacaacttatagtgtttgtgtcatattgttgagaaacgacttcgatccctagaaaggtcggtaaaaaagacgagagaggtattaaaaagtgataatg |
51671450 |
T |
 |
| Q |
209 |
aaccgtagttgttttgatagagctgcagaaaatcttaacccaatgaattatttgcatccacataaagaggaatcatttgtatgtgcagccacttacgttc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51671449 |
aaccgtagttgttttgatagagctgcagaaaatcttaacccaatgaattatttgcatccacataaagaggaatcatttgtatgtgcagccacttacgttc |
51671350 |
T |
 |
| Q |
309 |
ttgc |
312 |
Q |
| |
|
|||| |
|
|
| T |
51671349 |
ttgc |
51671346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University