View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_high_42 (Length: 293)
Name: NF16780_high_42
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_high_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 30781952 - 30782124
Alignment:
| Q |
18 |
tgaagacttggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaaccgtcccttttcttgcaaccattggtacaataagcgatgttcaa |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30781952 |
tgaagactaggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaacggtcccttctcttgcaaccattggtacaataagcgatgttcaa |
30782051 |
T |
|
| Q |
118 |
agagagaactttctttgttgttgcttgatcttcttactaggttatgcttcttcatagttctatcttgttattg |
190 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30782052 |
agagagaattttctttgttgttgcttgatcttcttactaggttatgcttcttcattgttctatcttgttattg |
30782124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 30782240 - 30782294
Alignment:
| Q |
221 |
gtcgggtctcctttcatgggcctttgtaacacggaattgttgcaactgactccgt |
275 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
30782240 |
gtcgggtctcctttcatgggaatttgtaacacggaattgttgcaaccgactccgt |
30782294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University