View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_high_62 (Length: 243)
Name: NF16780_high_62
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_high_62 |
 | |
|
| [»] scaffold0223 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0223 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 26 - 224
Target Start/End: Complemental strand, 11627 - 11429
Alignment:
| Q |
26 |
cctccatactgccactaactccgcctcctccatgtcgccgccggaatccccctccctccatccccatcacatcctcatcgtagcgctgtttttcgccgcc |
125 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11627 |
cctccataccgccactaactccgccaactccatgtcgccgccggaatccccctccctccatccccatcacatcctcatcgtagcgctgtttttcgccgcc |
11528 |
T |
|
| Q |
126 |
gtttctctctccaccttactcctctgcagagacgctgattactcttacttcgcttcctcttattccttccgttttccaaccgtttttccctccgcttcc |
224 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11527 |
gtttctctctccaccttactcctcttcagagacgctgattactcttacttcgcttcctcttattccttccgttttccaaccgtttttccctccgcttcc |
11429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University