View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_high_77 (Length: 209)
Name: NF16780_high_77
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_high_77 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 7221669 - 7221495
Alignment:
| Q |
16 |
ataatactacaccaagactcaaacactaatagctgaatgttagtagaataatataatatttgttcaaatcaaaattaatgttacaactccacaaaatcaa |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||| |||| |
|
|
| T |
7221669 |
ataatactacaccaagactcaaccactaatagctgaatgttagtagaataatataatatttgttaaaataaaaaataatgttacaactccacaaa-tcaa |
7221571 |
T |
 |
| Q |
116 |
gaaacaatagtttttctggcttctttgtagtcttgataattaccatagtcacttgatgttgttgtctttcgatggt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7221570 |
gaaacaatagtttttctggcttctttgtagtcttgataattaccatagtcacttgatgttgttgtctttcgatggt |
7221495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University