View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_10 (Length: 493)
Name: NF16780_low_10
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 3e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 196 - 333
Target Start/End: Original strand, 1731634 - 1731772
Alignment:
| Q |
196 |
gtaaaagaagcaacttgattttgtatcaaatttgggcaaacnnnnnnnnngaa-gatatgatttgatttgagtttttgttaaagaaagcaacttggttgt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1731634 |
gtaaaagaagcaacttgattttgtatcaaatttgggcaaacaaaaaaaaaaaaagatatgatttgatttgagtttttgttaaagaaagcaacttggttgt |
1731733 |
T |
 |
| Q |
295 |
gcatcacaaaattaggctgtgagaaaatgaattagaata |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1731734 |
gcatcacaaaattaggctgtgagaaaatgaattagaata |
1731772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 20 - 126
Target Start/End: Original strand, 1731468 - 1731574
Alignment:
| Q |
20 |
acctgaaactcacacacaattgagaagttcaggttcggacccaagtgaaggtgtttagtataacaatattgattttatgagttgagttacgtcttatgga |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1731468 |
acctgaaactcacacacaactgagaagttcaggtttggacccaagtgaaggtgtttagtataacaatattgattttatgagttgagttaggtcttatgga |
1731567 |
T |
 |
| Q |
120 |
cagatgg |
126 |
Q |
| |
|
||||||| |
|
|
| T |
1731568 |
cagatgg |
1731574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University