View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_25 (Length: 372)
Name: NF16780_low_25
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 364
Target Start/End: Original strand, 54572321 - 54572667
Alignment:
| Q |
18 |
acttttaaacactgaatccctgctataataatattgttgacaagagctttcattatcaacttctaatttgcatcatatcctatttgctcttatgccttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54572321 |
acttttaaacactgaatccctgctataataatattgttgacaagagctttcattatcaacttctaatttgcatcatatcctatttgctcttatgccttct |
54572420 |
T |
|
| Q |
118 |
caccctctgccgtgctgaagcgtcgttattttgacttatcaagggcaatgcagatttcaacagtcatcaccactcgcagtgtattgattttggatgagtt |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54572421 |
caccctccgccgtgctgaagcgtcgttattttgacttatcaagggcaatgcagatttcaacagtcatcaccactcgcagtgtattgattttggatgagtt |
54572520 |
T |
|
| Q |
218 |
gctacttgctattattagacaaatgtctactctttaaatgaataaaagaaagcaagtatatacaaacaactgcctacattttgtatcaagatatttcgaa |
317 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54572521 |
gctatt---aattattagacaaatgtctactctttaaatgaataaaagaaagcaagtatatacaaacaactgcctacattttgtatcaagatatttcgaa |
54572617 |
T |
|
| Q |
318 |
tctccctccacatttgcttgcacgttttattt---ttacattcctatgct |
364 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
54572618 |
tctccctacacatgtgcttgcacgttttatttaccttacattcctatgct |
54572667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 49 - 94
Target Start/End: Original strand, 54576895 - 54576940
Alignment:
| Q |
49 |
tattgttgacaagagctttcattatcaacttctaatttgcatcata |
94 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54576895 |
tatttttgacaagagctttcaacatcaacttctaatttgcatcata |
54576940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University