View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_31 (Length: 354)
Name: NF16780_low_31
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 17 - 340
Target Start/End: Original strand, 52376439 - 52376750
Alignment:
| Q |
17 |
attctatacttcaatcatcatctgtagaggtccctttaggtgctcctttaggtgcacctgaaggtgcaaccatttgatcatcgtcatcatcatcgtctgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52376439 |
attctatacttcaatcatcatctgtagaggtccctt------------taggtgcacctgaaggtgcaaccatttgatcatcgtcatcatcatcatctgt |
52376526 |
T |
 |
| Q |
117 |
tagatccccttgaggtgctccggctggcgacacaattggagcacttccaggtgctttagaactaccggctacattctcgccattgccttttggtgcctct |
216 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52376527 |
tagatccccttgaggtgctccggttggagacacaattggagcactttcaggtgctttagaactaccggctacattcgcgccattgccttttggtgcctct |
52376626 |
T |
 |
| Q |
217 |
gcaggcgcgttggtggatgctgctgtgggtgcatttgtgggtgcagattcaggtgttttgcttggttcgtttgatggtgcatttgttggtgcttgttgtg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52376627 |
gcaggcgcgttggtggatgctgctgtgggtgcatttgtgggtgcagattcaggtgttttgcttggttcgtttgatggtgcatttgttggtgcttgttgtg |
52376726 |
T |
 |
| Q |
317 |
gtgatttattggatgaaccatctg |
340 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52376727 |
gtgatttattggatgaaccatctg |
52376750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University