View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_34 (Length: 337)
Name: NF16780_low_34
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 12 - 297
Target Start/End: Complemental strand, 42351354 - 42351069
Alignment:
| Q |
12 |
atgaaaacggtggtgattgactgatagctccacaatggaggcagtgtacatgaaaacattgcgacgatctagtaagtaagcacatgagaaggaagattta |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42351354 |
atgaaaacgatggtgattgactgatagctccacaatggaggcggtgtacatgaaaacattgcgacgatctagtaagtaagcacatgagaaggaagattta |
42351255 |
T |
 |
| Q |
112 |
gggttaggaataatgtatatgagactgaaccgtgagttaggctttatagtaggagggttaaggttttaggacccaaagccttaattagatagttgtctta |
211 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42351254 |
gggttaggaataatgtacatgagcctaaaccgtgagttagggtttatagtaggagggttagggttttaggacccaaagccttaattagatagttgtctta |
42351155 |
T |
 |
| Q |
212 |
gaagccaaatgtcacaaatcatgatttggtctggatttgatgaccttaattcaatcaacgaattcactatagtatgactataaggc |
297 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42351154 |
gaagacaaatgtcacaaatcatgatttcgtctggatttgatgaccttaattcaatcaacgacttcactatagtatgactataaggc |
42351069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University