View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_40 (Length: 316)
Name: NF16780_low_40
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 299
Target Start/End: Complemental strand, 44735713 - 44735442
Alignment:
| Q |
19 |
tcatataaatacgcacacaccacattcatagttcataacaacccacaacacattcataacttcaatttgactttgttctataagaaagaaagaaagaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||| |||| ||| |||||||||||||||| | |
|
|
| T |
44735713 |
tcatataaatacgcacacaccacattcatagttcataacaacc-acaacacaaacataaa--caagcat-ctttattc-ataagaaagaaagaaa----c |
44735623 |
T |
|
| Q |
119 |
acacactcttcatgggcaacacaagttcttgttcttgcatccctactgatagttctagtttcgagatttttaatgagaaagtgataaagagtaagaagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44735622 |
acacactcttcatgggcaacacaagttcttgttcttgcatccctactgatagttctagtttcgagatttttaatgagaaagtgataaagagtaagaagaa |
44735523 |
T |
|
| Q |
219 |
aacaacaacgttgttggacactgacggaaacattcgagagatcaagctaccgatgaaatcagcagagctcatgattgaact |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44735522 |
aacaacaacgttgttggacactgacggaaacattcgagagatcaagctaccgatgaaatcagcagagctcatgattgaact |
44735442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 237
Target Start/End: Complemental strand, 44746107 - 44746044
Alignment:
| Q |
174 |
tagtttcgagatttttaatgagaaagtgataaagagtaagaagaaaacaacaacgttgttggac |
237 |
Q |
| |
|
|||||| || ||||||||||||||| | ||||||||||||||||||| |||||||||||||| |
|
|
| T |
44746107 |
tagttttgatatttttaatgagaaattagtaaagagtaagaagaaaacggcaacgttgttggac |
44746044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University